lt span lang 3dnl style 3d apos font size 14 0pt mso ansi language nl apos gt     the man jumped out of the boat he was bitten by a shark     3d gt after jumping out of the boat the man was bitten by a shark

Báo cáo y học: " The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to the small molecule maturation inhibitor 3-O-{3'''',3''''-"</h1> <p style="font-size:11px;margin-bottom:3px;">Chia sẻ: <a href="http://tailie

Báo cáo y học: " The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to the small molecule maturation inhibitor 3-O-{3'''',3''''-"</h1> <p style="font-size:11px;margin-bottom:3px;">Chia sẻ: <a href="http://tailie

Ngày tải lên : 13/08/2014, 13:20
... analysis of the 35S levels in the CA and CA-SP1 bands in the pulse-chase assays of Gag processing shown in Fig Quantitative analysis of the 35S levels in the CA and CA-SP1 bands in the pulse-chase assays ... GAAGGCTCGAGTACTGGCAGAAGCCATGAAAGAG (sense) and GGCTTCTGCCAGTACTCGAGCCTTC (antisense) Primers used to produce SIVm3 were: GAAGGCTCGAGTACTGGCAGAAGCCATGAAAGAG (sense) and TGGCTTCTGCCAGTACTCGAGCCTTTC (antisense) The PCR ... compound acts at a late stage of the HIV-1 replication cycle and results in the accumulation of an intermediate in the processing of Pr55Gag due to delayed cleavage at the CA-SP1 junction Although...
  • 10
  • 194
  • 0
Lịch sử   văn hoá làng phủ lý (kẻ rỵ) xã thiệu trung, huyện thiệu hoá, tỉnh thanh hoá (từ thế kỷ x đến năm 1945)

Lịch sử văn hoá làng phủ lý (kẻ rỵ) xã thiệu trung, huyện thiệu hoá, tỉnh thanh hoá (từ thế kỷ x đến năm 1945)

Ngày tải lên : 19/12/2013, 15:02
... hơng) Theo văn bia ch a Hơng Nghiêm "năm 1091, Lý Thờng Kiệt Thanh H a trả ruộng Ông lập bia đá chia ruộng cho hai giáp: Từ n a đầm A Lôi trở lên cho giáp Bối Lý, n a đầm A Lôi trở xuống chia cho ... huyện Thiệu H a (1926 - 1999)" BCH Đảng huyện Thiệu H a Đồng thời tham khảo thêm nguồn t liệu đ a chí tỉnh nh: Đ a chí Thanh H a (quyển 1- 2), Đ a chí Thọ Xuân, Đ a chí Hoằng H a, Đ a chí Quảng ... Đông Thanh) lên đến làng Trà Thợng (xã Thiệu Đô) làm thành đ a giới tự nhiên xã ph a đông bắc Ph a tây ph a nam làng cánh đồng l a hai vụ bát ngát chia ranh giới với xã Thiệu Lý (Thiệu H a) , Đông...
  • 162
  • 1.2K
  • 6
Vận động hành lang trong hoạt động lập pháp của quốc hội (nghị viện) một số nước trên thế giới

Vận động hành lang trong hoạt động lập pháp của quốc hội (nghị viện) một số nước trên thế giới

Ngày tải lên : 12/02/2014, 13:19
... Unabridged (v1.1) Based on the Random House Unabridged Dictionary, © Random House, Inc 2006 American Heritage Dictionary 29 European Pariament, “Lobbying in the European union: current rules and ... “History of the Lobbying Disclosure Act” 33 Stacie Fatka Jason Milé Levien, “Protecting the Right to Petition: Why a Lobbying Contingency Fee Prohibition Violates the Constitution” 35 Havard Journal ... Việt Nam Chương SỰ HÌNH THÀNH VÀ VỊ TRÍ, VAI TRÒ C A VẬN ĐỘNG HÀNH LANG 1.1 Vận động hành lang - lịch sử định ngh a 1.1.1 Lịch sử vận động hành lang Vận động hành lang (lobby) lấy theo tên đ a điểm...
  • 20
  • 519
  • 1
Tài liệu Out of the Shadows African American Baseball from the Cuban Giants to Jackie Robinson ppt

Tài liệu Out of the Shadows African American Baseball from the Cuban Giants to Jackie Robinson ppt

Ngày tải lên : 21/02/2014, 06:20
... team The attendance for the annual game was often the highest of the year [-8], (2) ✶ Parallel with serious Negro ball were the black clown teams, such as the Zulu Cannibal Giants, the Indianapolis ... and a shrewd hotel man Together, they devised a strategy for the survival of the Cuban Giants that would serve as a paradigm for the future of African American baseball The key was to play all ... ten-year run as one of the premier African American teams in the East But by the turn of the century, they no longer dominated African American baseball as they once had That dominance was a victim...
  • 241
  • 609
  • 0
Báo cáo khoa học: Nucleotide binding to human UMP-CMP kinase using fluorescent derivatives ) a screening based on affinity for the UMP-CMP binding site potx

Báo cáo khoa học: Nucleotide binding to human UMP-CMP kinase using fluorescent derivatives ) a screening based on affinity for the UMP-CMP binding site potx

Ngày tải lên : 07/03/2014, 09:20
... 1KD and 3KD, and resulting in the half-saturation of the enzyme at the start of the experiment [25] The uorescence decreased after each addition of unlabeled ligand Total displacement was checked ... and ADP also displaced Mant-ATP The bisubstrate analog Ap5U displaced Mant-ATP (K Ap5U 0.15 lm) better D than ATP (Fig 1) The other bisubstrate analogs in which U in Ap5U was replaced by A, ... glycerol) The reaction at 37 C was started by adding the enzyme followed by a phosphate acceptor at the desired concentration The absence of inhibition of the coupled system was carefully checked by...
  • 11
  • 468
  • 0
Prostate Cancer Screening : A Decision Guide for African Americans doc

Prostate Cancer Screening : A Decision Guide for African Americans doc

Ngày tải lên : 15/03/2014, 01:20
... cancer are the same Many factors affect the decision whether or not to treat the disease: the patient’s age, whether the cancer has spread, the presence of other medical conditions, and the patient’s ... PSA is a substance produced only by cells from the prostate gland and released into the blood The PSA test measures the PSA level in the blood A small amount of blood is drawn from the arm The ... removing the prostate; ■ external radiation therapy — destroying cancer cells by directing radiation at the prostate; ■ internal radiation therapy (brachytherapy) — surgically placing small radioactive...
  • 20
  • 354
  • 0
TOTAL BODY LIFT™ SURGERY: Reshaping the Breasts, Chest, Arms, Thighs, Hips, Back, Waist, Abdomen & Knees after Weight Loss, Aging & Pregnancies doc

TOTAL BODY LIFT™ SURGERY: Reshaping the Breasts, Chest, Arms, Thighs, Hips, Back, Waist, Abdomen & Knees after Weight Loss, Aging & Pregnancies doc

Ngày tải lên : 22/03/2014, 14:20
... excess skin and fat of the trunk, legs, arms, breasts, and face Many of these operations are dramatically more aggressive than earlier versions and yield results that are dramatically better as well ... plastic surgeons not feel that the marketed advantages outweigh the costs and risks Nevertheless I remain among the advocates Today the LySonix system (Mentor Corporation, Santa Barbara, California) ... average skin excision on a woman is 11 pounds After her single stage Total Body Lift surgery, Maria was a very happy woman However for the first several days, she was miserable She said, “There was...
  • 224
  • 249
  • 0
Nine Out of Ten Non-Elderly Californians Will Be Insured When the Affordable Care Act is Fully Implemented ppt

Nine Out of Ten Non-Elderly Californians Will Be Insured When the Affordable Care Act is Fully Implemented ppt

Ngày tải lên : 22/03/2014, 14:20
... the UCLA Fielding School of Public Health and affiliated with the UCLA Luskin School of Public Affairs The UCLA Center for Health Policy Research improves the public’s health by advancing health ... and Education Greg Watson is a data analyst at the UCLA Center for Health Policy Research Gerald F Kominski is the director of the UCLA Center for Health Policy Research and a professor at the ... UCLA Fielding School of Public Health Dylan H Roby is the director of the Health Economics and Evaluation Research Program at the UCLA Center for Health Policy Research and an assistant professor...
  • 8
  • 326
  • 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Ngày tải lên : 22/03/2014, 21:20
... from the cultivated yeast cells, and the coding region of the binding candidates was amplified by PCR using primers 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢ The final ratio ... the plasma membrane, and completely interrupted the migration of Gccyto towards the plasma membrane when the affinity constant of the competitor was equal to or greater than that of the membrane-associated ... recombination at the HOP2 promoter region was amplified from MC-F1 genomic DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted into the...
  • 9
  • 356
  • 0
Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt

Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt

Ngày tải lên : 23/03/2014, 06:20
... gccuccauuugauggugaagaugaa; PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa PKCe #1, PKCe #2 and PKC siRNAs are the ‘validated Stealth RNAi duo pak’ from Invitrogen ... accuaaagca uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca; ZIP8 #3, ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga cccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa; PKCa #2, gccuccauuugauggugaagaugaa; ... B was then added Absorbance was measured at 750 nm, and compared to the absorbance of dilutions of a protein standard to determine the protein concentration Each sample was measured in duplicate,...
  • 13
  • 331
  • 0
Báo cáo khoa học: The potyviral virus genome-linked protein VPg forms a ternary complex with the eukaryotic initiation factors eIF4E and eIF4G and reduces eIF4E affinity for a mRNA cap analogue ppt

Báo cáo khoa học: The potyviral virus genome-linked protein VPg forms a ternary complex with the eukaryotic initiation factors eIF4E and eIF4G and reduces eIF4E affinity for a mRNA cap analogue ppt

Ngày tải lên : 23/03/2014, 10:21
... spectrum was prevented In water, Raman scattering occurs % 30 nm above the excitation wavelength In the buffer used, the excitation at 258 nm was accompanied by a Raman peak at 282 nm, which was far ... shown) The excitation wavelength was set at 258 nm Although there is a contribution of m7GDP absorption at this wavelength, with our optical system the inner filter effect was about 2% at the highest ... discrepancies between the affinities of the cap analogue published so far In the absence of VPg, the value of the dissociation constant obtained (Kc ¼ 0.31 ± 0.02 lm) was significantly lower than in previous...
  • 11
  • 489
  • 0
The policemen were chasing after the burglar while I was going for a walk ppt

The policemen were chasing after the burglar while I was going for a walk ppt

Ngày tải lên : 02/04/2014, 21:20
... *The policemen were chasing after the burglar while I was going for a walk Hình thức cấu trúc ngữ pháp: “S + was/ were + V_ing + while + S + was/ were + V_ing” - Hai hành động xảy ... going for a walk 2 Các bạn di chuột vào cụm từ để biết chức cụm câu: The policemen were chasing after the burglar while I was going for a walk 3 Tại câu lại dịch vậy? Mệnh đề thứ nhất: The policemen ... trúc “S + was/ were + V_ing” Do chủ ngữ danh từ số nhiều (the policemen) nên động từ “to be” chia “were” Cụm động từ “chasing after – có động từ gốc “chase after = “run after = “drive after ...
  • 6
  • 461
  • 0
bones stones and molecules-out of africa and human origins

bones stones and molecules-out of africa and human origins

Ngày tải lên : 08/04/2014, 02:43
... 1999) The earliest Miocene also saw the genesis of the great African rift valleys, as a result of the formation of the Ethiopian highlands There was massive faulting as the external land surface ... barriers All the facts available indicate that racial characters made their appearance as individual variations 14 Chapter Introduction and, furthermore, that they started with a great range of variations ... respectively, as the Out of Africa” and the “Multiregional” hypotheses Does the paleontological, archaeological, and molecular evidence support the mass extinction of earlier humans, the last of all being...
  • 415
  • 243
  • 0
aslund a., dabrowski m. europe after enlargement. cambridge, 2007

aslund a., dabrowski m. europe after enlargement. cambridge, 2007

Ngày tải lên : 04/06/2014, 17:37
... clarification of the acquis, the increased authority of the Council, the increased authority of the democratically elected Parliament, and the scope of new social provisions The remainder of the ... to open the Pandora’s box of past agreements and fix them Its wholesale adoption of all the acquis communautaire, good and bad, left many of the important issues untouched Then the ratification process ... by periods of acceleration The last acceleration, the “re-launch of Europe” in the 1980s, led to the adoption of the Single European Act and the monetary union The fifth enlargement of 2004 has...
  • 255
  • 317
  • 0
utah state university press out of style reanimating stylistic study in composition and rhetoric jan 2008

utah state university press out of style reanimating stylistic study in composition and rhetoric jan 2008

Ngày tải lên : 11/06/2014, 12:44
... questions the disappearance of sentence rhetorics from composition theory and pedagogy after 1980 and makes the claim that their marginalization was the result of a growing wave of anti-formalism, anti-behaviorism, ... Safire nonetheless advocates adopting a style governed by rules of grammar and usage that give the impression that the author does not acknowledge a wealth of language variation Like Safire, David ... his analysis of Lysias’s “On the Refusal of a Pension to the Invalid,” Katula, noting the absence of a significant number of tropes and figures in the speech, argues that the “use of parallel...
  • 197
  • 359
  • 0
báo cáo sinh học:" Information needs of health care workers in developing countries: a literature review with a focus on Africa" doc

báo cáo sinh học:" Information needs of health care workers in developing countries: a literature review with a focus on Africa" doc

Ngày tải lên : 18/06/2014, 17:20
... diabetic complications as compared to mass media and health news." The quality of health education is clearly dependent on the knowledge of the health worker A cross-sectional study of the quality ... the health worker at the point of care, e.g on the table) Language The studies revealed little about the central issue of language Given that most available health care information is in English, ... "Whenever observation methods are applied, the question arises of whether the presence of the observer may cause a Hawthorne effect, in the sense that the health care worker may have followed the...
  • 13
  • 558
  • 0
báo cáo hóa học: " A case of isocyanate-induced asthma possibly complicated by food allergy after peanut consumption: a case report" ppt

báo cáo hóa học: " A case of isocyanate-induced asthma possibly complicated by food allergy after peanut consumption: a case report" ppt

Ngày tải lên : 20/06/2014, 00:20
... In addition, three years ago he developed an anaphylactic reaction due to peanut consumption The patient manifested classical symptoms of anaphylaxis as urticaria, angioedema and dispnoea He ... developed labial itching, as well as orbital and perioral angioedema Afterwards, he followed a strict peanut elimination diet All these findings confirm the diagnoses of occupational asthma and rhinitis ... complication of isocyanate-induced occupational asthma by food allergy is reported at least in two cases and the implicated foods were the plants of the mustard family [19,20] The suggested phys-pathological...
  • 4
  • 414
  • 0
báo cáo hóa học:" Medial pelvic migration of the lag screw in a short gamma nail after hip fracture fixation: a case report and review of the literature" potx

báo cáo hóa học:" Medial pelvic migration of the lag screw in a short gamma nail after hip fracture fixation: a case report and review of the literature" potx

Ngày tải lên : 20/06/2014, 04:20
... the dynamized position of the Gamma nail We theorized that over time with the compression of the fracture and dynamization of the nail in the setting of an unstable fracture pattern, there was ... fixation devices developed for the management of these fractures, with majority of them belonging to either the intrameduallary or the sliding hip plate category The advantages of intrameduallary ... toggling of the nail within the intrameduallary canal which led to the medial migration of the Lag Screw with repeated axial loading This is the mechanism as proposed by Weil et al in their biomechanical...
  • 7
  • 464
  • 0
báo cáo hóa học:" Medial pelvic migration of the lag screw in a short gamma nail after hip fracture fixation: a case report and review of the literature" pot

báo cáo hóa học:" Medial pelvic migration of the lag screw in a short gamma nail after hip fracture fixation: a case report and review of the literature" pot

Ngày tải lên : 20/06/2014, 07:20
... the dynamized position of the Gamma nail We theorized that over time with the compression of the fracture and dynamization of the nail in the setting of an unstable fracture pattern, there was ... fixation devices developed for the management of these fractures, with majority of them belonging to either the intrameduallary or the sliding hip plate category The advantages of intrameduallary ... toggling of the nail within the intrameduallary canal which led to the medial migration of the Lag Screw with repeated axial loading This is the mechanism as proposed by Weil et al in their biomechanical...
  • 7
  • 476
  • 0
báo cáo hóa học:" Changes in the SF-8 scores among healthy non-smoking school teachers after the enforcement of a smoke-free school policy: a comparison by passive smoke status" doc

báo cáo hóa học:" Changes in the SF-8 scores among healthy non-smoking school teachers after the enforcement of a smoke-free school policy: a comparison by passive smoke status" doc

Ngày tải lên : 20/06/2014, 16:20
... Environmental Medicine 1997, 39(11):1111-1 114 30 Shibata A, Oka K, Nakamura Y, Muraoka I: Recommended level of physical activity and health-related quality of life among Japanese adults Health and quality ... survey All authors read and approved the final manuscript Acknowledgements This study was supported by a Grant-in-Aid for Scientific Research from the Ministry of Health, Labor, and Welfare of Japan ... generated by the linear regression analyses The results of the univariable and multivariable analyses were quite similar All of the category scores, but for RP among passive smokers, increased...
  • 8
  • 353
  • 0

Xem thêm